|
Thermo Fisher
receptor dna construct Receptor Dna Construct, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcdna+3%2E0/pmc07247315-466-11-30?v=Thermo+Fisher Average 99 stars, based on 1 article reviews
receptor dna construct - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Addgene inc
david sacks David Sacks, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcdna+3%2E0/pm37488602-55-12-14?v=Addgene+inc Average 92 stars, based on 1 article reviews
david sacks - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pcdna3 1 myc Pcdna3 1 Myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcdna+3%2E0/pmc04842985-145-14-50?v=Addgene+inc Average 92 stars, based on 1 article reviews
pcdna3 1 myc - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pcdna3 flag mkk6 k82a Pcdna3 Flag Mkk6 K82a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcdna+3%2E0/10__1128_slash_mcb__01006___10-65-16-6?v=Addgene+inc Average 92 stars, based on 1 article reviews
pcdna3 flag mkk6 k82a - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
Addgene inc
atcatggtatctcccctgccaggtaagtat Atcatggtatctcccctgccaggtaagtat, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcdna+3%2E0/bio_rxiv__2020__02__28__970442-124-28-19?v=Addgene+inc Average 93 stars, based on 1 article reviews
atcatggtatctcccctgccaggtaagtat - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Promega
pcdna3.1 Pcdna3.1, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcdna+3%2E0/10__1074_slash_jbc__m804597200-96-15-13?v=Promega Average 90 stars, based on 1 article reviews
pcdna3.1 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Addgene inc
pcr amplifying gamillus Pcr Amplifying Gamillus, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcdna+3%2E0/pm40188316-83-50-61?v=Addgene+inc Average 93 stars, based on 1 article reviews
pcr amplifying gamillus - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Addgene inc
sgrna2 263 Sgrna2 263, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcdna+3%2E0/pm35402874-237-27-37?v=Addgene+inc Average 93 stars, based on 1 article reviews
sgrna2 263 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
GenScript corporation
pcdna3.1(+)-n-egfp-human cldn11 (last 30 mino acids) 208glnext39 ![]() Pcdna3.1(+) N Egfp Human Cldn11 (Last 30 Mino Acids) 208glnext39, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcdna+3%2E0/pmc11995805-21-0-8?v=GenScript+corporation Average 90 stars, based on 1 article reviews
pcdna3.1(+)-n-egfp-human cldn11 (last 30 mino acids) 208glnext39 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Nagai Nori USA INC
gamillus ![]() Gamillus, supplied by Nagai Nori USA INC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcdna+3%2E0/pm40188316-83-86-96?v=Nagai+Nori+USA+INC Average 90 stars, based on 1 article reviews
gamillus - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Mirus Bio
msi2 pcdna3 1 in nih3t3 30 cells using transit x2 ![]() Msi2 Pcdna3 1 In Nih3t3 30 Cells Using Transit X2, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcdna+3%2E0/pm35528200-81-13-20?v=Mirus+Bio Average 98 stars, based on 1 article reviews
msi2 pcdna3 1 in nih3t3 30 cells using transit x2 - by Bioz Stars,
2026-08
98/100 stars
|
Buy from Supplier |
|
Microsynth ag
sirna_l3mbt1_7 ![]() Sirna L3mbt1 7, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcdna+3%2E0/pmc08170441__mmc3-253-161-161?v=Microsynth+ag Average 90 stars, based on 1 article reviews
sirna_l3mbt1_7 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: BBA Advances
Article Title: Claudin-11, a hypomyelinating leukodystrophy 22 (HLD22)-responsible protein, uniquely interacts with shroom-2 to change cell phenotypes
doi: 10.1016/j.bbadva.2025.100159
Figure Lengend Snippet: Key materials used in this study.
Article Snippet: pcDNA3.1(
Techniques: Western Blot, Sequencing, Immunoprecipitation, Concentration Assay, Plasmid Preparation
Journal: BBA Advances
Article Title: Claudin-11, a hypomyelinating leukodystrophy 22 (HLD22)-responsible protein, uniquely interacts with shroom-2 to change cell phenotypes
doi: 10.1016/j.bbadva.2025.100159
Figure Lengend Snippet: Knockdown of claudin-11 decreases cell morphology and marker protein expression. (A, B) FBD-102b cells were transfected with control luciferase siRNA (siControl) or claudin-11 siRNA (siClaudin11) and cultured for 0 or 3 days following the induction of differentiation. Cells meeting differentiation criteria were counted and statistically depicted in the graph (** p < 0.01; n = 10 fields). Panels a and b (lower photographs) are enlarged images of squares a and b surrounded by black dotted lines (middle photographs). Some cells are surrounded by white dotted lines. (C and D) And, cell lysates following the induction of differentiation were immunoblotted with the respective antibodies against differentiation marker proteins MBP and PLP1, as well as the internal control actin. The immunoreactive bands of interest were quantified and graphed, with other immunoreactive bands set to 100 % (* p < 0.05; n = 3 blots).
Article Snippet: pcDNA3.1(
Techniques: Knockdown, Marker, Expressing, Transfection, Control, Luciferase, Cell Culture
Journal: BBA Advances
Article Title: Claudin-11, a hypomyelinating leukodystrophy 22 (HLD22)-responsible protein, uniquely interacts with shroom-2 to change cell phenotypes
doi: 10.1016/j.bbadva.2025.100159
Figure Lengend Snippet: Transfection of the PDZ ligand sequence of claudin-11 decreases cell morphology and marker protein expression. (A, B) Cells were transfected with a control vector (Control) or the plasmid encoding the GFP-tagged PDZ ligand sequence of claudin-11 (claudin-11 [C]) and cultured for 0 or 3 days following the induction of differentiation. Cells meeting differentiation criteria were counted and statistically depicted in the graph (*** p < 0.001; n = 10 fields). Panels a and b (lower photographs) are enlarged images of squares a and b surrounded by black dotted lines (middle photographs). Some cells are surrounded by white dotted lines. (C and D) And, cell lysates following the induction of differentiation were immunoblotted with the respective antibodies against differentiation marker proteins, tagged protein (GFP-claudin [C]), and actin. The immunoreactive bands of interest were quantified and graphed, with other immunoreactive bands set to 100 % (** p < 0.01, * p < 0.05; n = 3 blots).
Article Snippet: pcDNA3.1(
Techniques: Transfection, Sequencing, Marker, Expressing, Control, Plasmid Preparation, Cell Culture
Journal: BBA Advances
Article Title: Claudin-11, a hypomyelinating leukodystrophy 22 (HLD22)-responsible protein, uniquely interacts with shroom-2 to change cell phenotypes
doi: 10.1016/j.bbadva.2025.100159
Figure Lengend Snippet: Knockdown of claudin-11 decreases the phosphorylation level of Akt kinase. (A, B) Cells were transfected with control luciferase siRNA (siControl) or claudin-11 siRNA (siClaudin11) and allowed to differentiate for 2 days. Cell lysates were immunoblotted with the respective antibodies against phosphorylated Akt kinase (pAkt) and total Akt kinase (Akt). The immunoreactive bands of interest were quantified and graphed, with other immunoreactive bands set to 100 % (** p < 0.01; n = 3 blots).
Article Snippet: pcDNA3.1(
Techniques: Knockdown, Phospho-proteomics, Transfection, Control, Luciferase