pcdna 3.0 Search Results


99
Thermo Fisher receptor dna construct
Receptor Dna Construct, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3%2E0/pmc07247315-466-11-30?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
receptor dna construct - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

92
Addgene inc david sacks
David Sacks, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3%2E0/pm37488602-55-12-14?v=Addgene+inc
Average 92 stars, based on 1 article reviews
david sacks - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

92
Addgene inc pcdna3 1 myc
Pcdna3 1 Myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3%2E0/pmc04842985-145-14-50?v=Addgene+inc
Average 92 stars, based on 1 article reviews
pcdna3 1 myc - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

92
Addgene inc pcdna3 flag mkk6 k82a
Pcdna3 Flag Mkk6 K82a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3%2E0/10__1128_slash_mcb__01006___10-65-16-6?v=Addgene+inc
Average 92 stars, based on 1 article reviews
pcdna3 flag mkk6 k82a - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

93
Addgene inc atcatggtatctcccctgccaggtaagtat
Atcatggtatctcccctgccaggtaagtat, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3%2E0/bio_rxiv__2020__02__28__970442-124-28-19?v=Addgene+inc
Average 93 stars, based on 1 article reviews
atcatggtatctcccctgccaggtaagtat - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

90
Promega pcdna3.1
Pcdna3.1, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3%2E0/10__1074_slash_jbc__m804597200-96-15-13?v=Promega
Average 90 stars, based on 1 article reviews
pcdna3.1 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

93
Addgene inc pcr amplifying gamillus
Pcr Amplifying Gamillus, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3%2E0/pm40188316-83-50-61?v=Addgene+inc
Average 93 stars, based on 1 article reviews
pcr amplifying gamillus - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc sgrna2 263
Sgrna2 263, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3%2E0/pm35402874-237-27-37?v=Addgene+inc
Average 93 stars, based on 1 article reviews
sgrna2 263 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

90
GenScript corporation pcdna3.1(+)-n-egfp-human cldn11 (last 30 mino acids) 208glnext39
Key materials used in this study.
Pcdna3.1(+) N Egfp Human Cldn11 (Last 30 Mino Acids) 208glnext39, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3%2E0/pmc11995805-21-0-8?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
pcdna3.1(+)-n-egfp-human cldn11 (last 30 mino acids) 208glnext39 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Nagai Nori USA INC gamillus
Key materials used in this study.
Gamillus, supplied by Nagai Nori USA INC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3%2E0/pm40188316-83-86-96?v=Nagai+Nori+USA+INC
Average 90 stars, based on 1 article reviews
gamillus - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

98
Mirus Bio msi2 pcdna3 1 in nih3t3 30 cells using transit x2
Key materials used in this study.
Msi2 Pcdna3 1 In Nih3t3 30 Cells Using Transit X2, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3%2E0/pm35528200-81-13-20?v=Mirus+Bio
Average 98 stars, based on 1 article reviews
msi2 pcdna3 1 in nih3t3 30 cells using transit x2 - by Bioz Stars, 2026-08
98/100 stars
  Buy from Supplier

90
Microsynth ag sirna_l3mbt1_7
Key materials used in this study.
Sirna L3mbt1 7, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3%2E0/pmc08170441__mmc3-253-161-161?v=Microsynth+ag
Average 90 stars, based on 1 article reviews
sirna_l3mbt1_7 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Key materials used in this study.

Journal: BBA Advances

Article Title: Claudin-11, a hypomyelinating leukodystrophy 22 (HLD22)-responsible protein, uniquely interacts with shroom-2 to change cell phenotypes

doi: 10.1016/j.bbadva.2025.100159

Figure Lengend Snippet: Key materials used in this study.

Article Snippet: pcDNA3.1(+)-N-eGFP-human Cldn11 (last 30 mino acids) 208GlnExt39 , Genscript , J377 × 912G0–4 , RG396977 , 1.25 μg of DNA per 6 cm dish.

Techniques: Western Blot, Sequencing, Immunoprecipitation, Concentration Assay, Plasmid Preparation

Knockdown of claudin-11 decreases cell morphology and marker protein expression. (A, B) FBD-102b cells were transfected with control luciferase siRNA (siControl) or claudin-11 siRNA (siClaudin11) and cultured for 0 or 3 days following the induction of differentiation. Cells meeting differentiation criteria were counted and statistically depicted in the graph (** p < 0.01; n = 10 fields). Panels a and b (lower photographs) are enlarged images of squares a and b surrounded by black dotted lines (middle photographs). Some cells are surrounded by white dotted lines. (C and D) And, cell lysates following the induction of differentiation were immunoblotted with the respective antibodies against differentiation marker proteins MBP and PLP1, as well as the internal control actin. The immunoreactive bands of interest were quantified and graphed, with other immunoreactive bands set to 100 % (* p < 0.05; n = 3 blots).

Journal: BBA Advances

Article Title: Claudin-11, a hypomyelinating leukodystrophy 22 (HLD22)-responsible protein, uniquely interacts with shroom-2 to change cell phenotypes

doi: 10.1016/j.bbadva.2025.100159

Figure Lengend Snippet: Knockdown of claudin-11 decreases cell morphology and marker protein expression. (A, B) FBD-102b cells were transfected with control luciferase siRNA (siControl) or claudin-11 siRNA (siClaudin11) and cultured for 0 or 3 days following the induction of differentiation. Cells meeting differentiation criteria were counted and statistically depicted in the graph (** p < 0.01; n = 10 fields). Panels a and b (lower photographs) are enlarged images of squares a and b surrounded by black dotted lines (middle photographs). Some cells are surrounded by white dotted lines. (C and D) And, cell lysates following the induction of differentiation were immunoblotted with the respective antibodies against differentiation marker proteins MBP and PLP1, as well as the internal control actin. The immunoreactive bands of interest were quantified and graphed, with other immunoreactive bands set to 100 % (* p < 0.05; n = 3 blots).

Article Snippet: pcDNA3.1(+)-N-eGFP-human Cldn11 (last 30 mino acids) 208GlnExt39 , Genscript , J377 × 912G0–4 , RG396977 , 1.25 μg of DNA per 6 cm dish.

Techniques: Knockdown, Marker, Expressing, Transfection, Control, Luciferase, Cell Culture

Transfection of the PDZ ligand sequence of claudin-11 decreases cell morphology and marker protein expression. (A, B) Cells were transfected with a control vector (Control) or the plasmid encoding the GFP-tagged PDZ ligand sequence of claudin-11 (claudin-11 [C]) and cultured for 0 or 3 days following the induction of differentiation. Cells meeting differentiation criteria were counted and statistically depicted in the graph (*** p < 0.001; n = 10 fields). Panels a and b (lower photographs) are enlarged images of squares a and b surrounded by black dotted lines (middle photographs). Some cells are surrounded by white dotted lines. (C and D) And, cell lysates following the induction of differentiation were immunoblotted with the respective antibodies against differentiation marker proteins, tagged protein (GFP-claudin [C]), and actin. The immunoreactive bands of interest were quantified and graphed, with other immunoreactive bands set to 100 % (** p < 0.01, * p < 0.05; n = 3 blots).

Journal: BBA Advances

Article Title: Claudin-11, a hypomyelinating leukodystrophy 22 (HLD22)-responsible protein, uniquely interacts with shroom-2 to change cell phenotypes

doi: 10.1016/j.bbadva.2025.100159

Figure Lengend Snippet: Transfection of the PDZ ligand sequence of claudin-11 decreases cell morphology and marker protein expression. (A, B) Cells were transfected with a control vector (Control) or the plasmid encoding the GFP-tagged PDZ ligand sequence of claudin-11 (claudin-11 [C]) and cultured for 0 or 3 days following the induction of differentiation. Cells meeting differentiation criteria were counted and statistically depicted in the graph (*** p < 0.001; n = 10 fields). Panels a and b (lower photographs) are enlarged images of squares a and b surrounded by black dotted lines (middle photographs). Some cells are surrounded by white dotted lines. (C and D) And, cell lysates following the induction of differentiation were immunoblotted with the respective antibodies against differentiation marker proteins, tagged protein (GFP-claudin [C]), and actin. The immunoreactive bands of interest were quantified and graphed, with other immunoreactive bands set to 100 % (** p < 0.01, * p < 0.05; n = 3 blots).

Article Snippet: pcDNA3.1(+)-N-eGFP-human Cldn11 (last 30 mino acids) 208GlnExt39 , Genscript , J377 × 912G0–4 , RG396977 , 1.25 μg of DNA per 6 cm dish.

Techniques: Transfection, Sequencing, Marker, Expressing, Control, Plasmid Preparation, Cell Culture

Knockdown of claudin-11 decreases the phosphorylation level of Akt kinase. (A, B) Cells were transfected with control luciferase siRNA (siControl) or claudin-11 siRNA (siClaudin11) and allowed to differentiate for 2 days. Cell lysates were immunoblotted with the respective antibodies against phosphorylated Akt kinase (pAkt) and total Akt kinase (Akt). The immunoreactive bands of interest were quantified and graphed, with other immunoreactive bands set to 100 % (** p < 0.01; n = 3 blots).

Journal: BBA Advances

Article Title: Claudin-11, a hypomyelinating leukodystrophy 22 (HLD22)-responsible protein, uniquely interacts with shroom-2 to change cell phenotypes

doi: 10.1016/j.bbadva.2025.100159

Figure Lengend Snippet: Knockdown of claudin-11 decreases the phosphorylation level of Akt kinase. (A, B) Cells were transfected with control luciferase siRNA (siControl) or claudin-11 siRNA (siClaudin11) and allowed to differentiate for 2 days. Cell lysates were immunoblotted with the respective antibodies against phosphorylated Akt kinase (pAkt) and total Akt kinase (Akt). The immunoreactive bands of interest were quantified and graphed, with other immunoreactive bands set to 100 % (** p < 0.01; n = 3 blots).

Article Snippet: pcDNA3.1(+)-N-eGFP-human Cldn11 (last 30 mino acids) 208GlnExt39 , Genscript , J377 × 912G0–4 , RG396977 , 1.25 μg of DNA per 6 cm dish.

Techniques: Knockdown, Phospho-proteomics, Transfection, Control, Luciferase